NCI-designated Cancer Center - PDFSEARCH.IO - Document Search Engine

NCI-designated Cancer Center
Results: 424

#	Item
21	May 30, 2012 The Honorable John Boehner Speaker United States House of Representatives The Honorable Nancy Pelosi Add to Reading List Source URL: braintumor.org Language: English - Date: 2014-05-12 11:32:56 War on Cancer Association of American Cancer Institutes NCI-designated Cancer Center Yale Cancer Center Cancer research National Institutes of Health Breast cancer Prostate cancer University of Pittsburgh Cancer Institute Medicine Cancer organizations Oncology
22	LOGO USAGE POLICY (Updated November 5, 2013) I. Use of NCI Cancer Center Logos Add to Reading List Source URL: cancercenters.cancer.gov Language: English - Date: 2013-11-05 10:31:32 National Institutes of Health National Cancer Institute NCI-designated Cancer Center The Cancer Genome Atlas Medicine Cancer organizations Cancer research
23	Cancer Center Support Grant Add to Reading List Source URL: prevention.nih.gov Language: English - Date: 2015-04-23 15:34:54 Health University of Pittsburgh Cancer Institute Research NCI-designated Cancer Center Clinical trial Medicine Cancer organizations University of Pittsburgh
24	CTGACTGATAGTCACTGGAGTCATAGCTGACTGACATGCAAATCAACTGACTGACTGAAAGTCACTGTGGTCAAAACTGACTGACTATG GTCACTGGTGTCAAAACTGACTGACTGAAAGTCACGATAACTGAGGGGGGTCAAAACTGACTGACTGAAAGTCACTGGGGTCTAAGGC CTGACTGAAAGTCACTGAGGTCAATACTGACTGACTATGTA Add to Reading List Source URL: www.aaci-cancer.org Language: English - Date: 2015-01-20 15:57:20 Yale Cancer Center NCI-designated Cancer Center University of Chicago Comprehensive Cancer Center Cancer research University of Texas MD Anderson Cancer Center Duke Cancer Institute Cancer organizations Medicine Association of American Cancer Institutes
25	Community for a Cure USC NORRIS CANCER FUND NEWSLETTER Fall 2014 — Issue 6 Fall 2014 — Issue 6 Add to Reading List Source URL: www.uscnorris.com Language: English - Date: 2014-11-05 14:27:55 Keck School of Medicine of USC USC Norris Comprehensive Cancer Center Oncology Hepatocellular carcinoma University of Southern California Cancer survivor Liver cancer Cancer NCI-designated Cancer Center Medicine Hepatology Cancer organizations
26	HopeCONNECTION Vol. 8, No. 4 Fall 2014 Edition Carol Duran: A MOTHER’S STORY Add to Reading List Source URL: cityofhope.org Language: English Ribbon symbolism Cancer screening Breast cancer awareness National Breast Cancer Awareness Month Mammography Cancer survivor NCI-designated Cancer Center City of Hope National Medical Center Medicine Oncology Breast cancer
27	USC NORRIS CANCER FUND: Community for a Cure Welcoming donors at all levels, working together as a community, investing in research to make cancer a disease of the past. ANNUAL MEMBERSHIP LEVELS Membership Level Add to Reading List Source URL: www.uscnorris.com Language: English - Date: 2014-08-29 13:46:30 University of Southern California USC Norris Comprehensive Cancer Center Medicine Columbia South Carolina USC Trojans football NCI-designated Cancer Center USC Trojans South Carolina University of South Carolina Keck School of Medicine of USC Cancer organizations Association of American Universities
28	under the MICROSCOPE F U N D I NG C A N C ER RESEARCH S INCESpring 2015 Volume XXIV Add to Reading List Source URL: www.concernfoundation.org Language: English - Date: 2015-05-19 18:28:29 University of Southern California Sports NCI-designated Cancer Center Breast cancer Ribbon symbolism Marathon
29	Patient-Centered Communication in Cancer Care: Promoting Healing & Reducing Suffering Add to Reading List Source URL: appliedresearch.cancer.gov Language: English - Date: 2013-10-17 12:57:20 National Institutes of Health Health communication Outcomes research NCI-designated Cancer Center Health informatics Gary L Kreps Medicine Health Cancer research
30	Submit your childhood cancer experience for an opportunity to win a Scholarship Award for College Submission Due Date- EXTENDED: April 17, 2015 by 5:00 p.m. Keaton Raphael Memorial has created the “John McLean Hero Aw Add to Reading List Source URL: childcancer.org Language: English - Date: 2015-04-08 12:45:55 Health NCI-designated Cancer Center Medicine Cancer